View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17271_low_9 (Length: 266)
Name: NF17271_low_9
Description: NF17271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17271_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 7 - 207
Target Start/End: Original strand, 31641676 - 31641876
Alignment:
| Q |
7 |
ggaggagcagagaggttggtgtgaaaatttggagattcaggcttgatgttgtggtggagagtattattaaggttgctagggttagggttttgttgaggtg |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641676 |
ggaggagaagagaggttggtgtgaaaatttggagattcaggcttgatgttgtggtggagagtattattaaggttgctagggttagggttttgttgaggtg |
31641775 |
T |
 |
| Q |
107 |
ggtcccaggtgatgtggctttgtgggttttggaaactttgttgttgatttgggaagaggaaaagagattggactaatgggtttgtgtttgtggtgatgat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31641776 |
ggtcccaggtgatgtggctttgtgggttttggaaactttgttgttgatttgggaagaggaaaagagattggactaatgggtttgtgtttgtggtggtgat |
31641875 |
T |
 |
| Q |
207 |
g |
207 |
Q |
| |
|
| |
|
|
| T |
31641876 |
g |
31641876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University