View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17273_low_5 (Length: 401)
Name: NF17273_low_5
Description: NF17273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17273_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 20 - 275
Target Start/End: Original strand, 12196918 - 12197173
Alignment:
| Q |
20 |
caggggaatggcacaacaatgtagaaagtgtggtgatgataaaagtaagagaaaatgaagaaagaggaaagtttggtagagtgtaaaatagagtaacgtt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12196918 |
caggggaatggcacaacaatgtagaaagtgtggtgatgataaaagtaggagaaaatgaagaaagaggaaagtttggtagagtgtaaaatagagtaacgtt |
12197017 |
T |
 |
| Q |
120 |
tttatgcaagattttgttcttttttgaagaggattattcggaaagtacgaagtgtgttttgaaacaaaatggattgtgttttgacgacgcggcgagcgat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12197018 |
tttatgcaagattttgttcttttttgaagaggattattcggaaagtacgaagtgtgttttgaaacaaaatggattgtgttttgacgacgcggcgagcgat |
12197117 |
T |
 |
| Q |
220 |
gtttttggggttggcaactttacatgttcattctccagctggcaatggcatggctc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12197118 |
gtttttggggttggcaactttacatgttcattctccagctggcaatggcatggctc |
12197173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University