View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17273_low_6 (Length: 386)
Name: NF17273_low_6
Description: NF17273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17273_low_6 |
 | |
|
| [»] scaffold0050 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0050 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 11 - 339
Target Start/End: Original strand, 72008 - 72331
Alignment:
| Q |
11 |
cagagacggtagaaataagaatcttgtcttctcaaatacgtggacgaatccatttccttgtttga-ttatgcagggctgagatactgaggtgcatgagct |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
72008 |
cagagacggtagaaataagaatcttgtcttctcaaatacgtggacgaatccatttccttgtttgaattatgcagggctgagatagtgaggtgcatgagct |
72107 |
T |
|
| Q |
110 |
tggaattgacgggagaaatggatacattatgttattgttttacagagaaatatctttatcgaatttcgcgggttctataacttaaggcaacttccaatac |
209 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
72108 |
tggaattgacgggaaaattggatacattatattattgttttacagagaaatatctttatcgaatttcgcgcgttctataacttaaggcaacttccaatac |
72207 |
T |
|
| Q |
210 |
atgtttaaacaccttcataaaccctcaatgttttcggattttataatctgaataggacgtgcgaaaagaaaggagggtggaatagaaataaccataaatt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
72208 |
atgtttaaacaccttcataaaccctcaatgttttcagattttataatctgaataggacgtgcgaaaagaaaggagggtggaatagaaataaccgtaaat- |
72306 |
T |
|
| Q |
310 |
aatgatggttgtcgactcattaggttcata |
339 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
72307 |
-----tggttgtcgactcattaggttcata |
72331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University