View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17274_high_23 (Length: 226)
Name: NF17274_high_23
Description: NF17274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17274_high_23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 4191485 - 4191275
Alignment:
| Q |
18 |
aagtgaaatggaaaactaatttacaagcctttgctcgtaacaacttaatatttctaattgcaatttaatatcaacagtattcagtnnnnnnn--tctcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4191485 |
aagtgaaatggaaaactaatttacaagcctttgctcgtaaatacttaatatttctaattgcaatttaatatcaacagtattcagtaaaaaaaattctcat |
4191386 |
T |
 |
| Q |
116 |
tgcagacagtaatataacctttttaactaggttggatgttttgcttatgataagatatttttgcatatgtatatagaagacagccgtgttatttagaaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4191385 |
tgcagacagtaatataacctttttaactaggttggatgttttgcttatgataagatatttttgcatatgtatatagaagacagccgtgttatttagaaac |
4191286 |
T |
 |
| Q |
216 |
acgaaagctga |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
4191285 |
acgaaagctga |
4191275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University