View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17274_high_8 (Length: 367)
Name: NF17274_high_8
Description: NF17274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17274_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 182 - 352
Target Start/End: Complemental strand, 44667680 - 44667510
Alignment:
| Q |
182 |
aatgataaattgtagagtgtggtgagtgatgaggggatataagaaaaataatggcagtagttaattggtggtggatgttaagtatgagcttctagatttt |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44667680 |
aatgataaattgtagagtgtggtgagtgatgaggggataaaagaaaaataatggcagtagttaattggtggtggatgttaagtatgaggttctagatttt |
44667581 |
T |
 |
| Q |
282 |
tctgatgtgattgatgagaatgaagaggatgaaagatttgaggggtgggtcggtatgtgtagtgtaatgaa |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44667580 |
tctgatgtgattgatgagaatgaagaggatgaaagatttgaggggtgggtcggtatgtgtaatgtaatgaa |
44667510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 22 - 145
Target Start/End: Complemental strand, 44667832 - 44667719
Alignment:
| Q |
22 |
agagaagtcatttgttgaagaaaaagaaggattgaattgagttgagttgacttgattagaaaggaagaagagttgtatagatatatagaggtgggtgtag |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44667832 |
agagaagtcatttgttgaagaaaaagaaggattgaattgagttgact----------agaaaggaagaagagttgtatagatatatagaggtgggtgtag |
44667743 |
T |
 |
| Q |
122 |
gtgagattgcttaatggaagatat |
145 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
44667742 |
gtgagattgcttaatgggagatat |
44667719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University