View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17274_high_9 (Length: 366)
Name: NF17274_high_9
Description: NF17274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17274_high_9 |
 |  |
|
| [»] scaffold0189 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 13813 - 13993
Alignment:
| Q |
18 |
gagagtgcatgcataatac---agttctttatctctattcttcgttagtattaacaaatccgttttcaagtttccactcatcagttcagtgtttcatgaa |
114 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13813 |
gagagtgcatgcataatactacagttctttatctctgttcttcgttagtattaacaaatccattttcaagtttccactcatcagttcagtgtttcttgaa |
13912 |
T |
 |
| Q |
115 |
gtgaaaactcttgagattcttagttaggaagaaaacacaatgaaccgttcaacttcaaggaagaagaatgctagttactat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13913 |
gtgaaaactcttgagattcttagttaggaagaaaacacaatgaaccgttcaacttcaaggaagaagaatgctagttactat |
13993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0189; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 260 - 312
Target Start/End: Original strand, 13993 - 14045
Alignment:
| Q |
260 |
tttacaaaaacaaggttttgaaaacttctttctcttactctatcacattatca |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13993 |
tttacaaaaacaaggttttgaaaacttctttctcttactctatcacattatca |
14045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 200 - 261
Target Start/End: Complemental strand, 34632565 - 34632504
Alignment:
| Q |
200 |
atcaaaacttcatcaacgccatgttttcttggtctcttcaagacattttcaaccaagatctt |
261 |
Q |
| |
|
|||| |||||||||||| | || |||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
34632565 |
atcataacttcatcaacactattttttcttggtctcttcaagaaattttcaaccatgatctt |
34632504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University