View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17274_low_15 (Length: 308)

Name: NF17274_low_15
Description: NF17274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17274_low_15
NF17274_low_15
[»] chr5 (1 HSPs)
chr5 (8-308)||(2385420-2385723)


Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 8 - 308
Target Start/End: Complemental strand, 2385723 - 2385420
Alignment:
8 cgaagaatatcttttgtttttctctagagggatgattattttctatatttgaatactgttctgtgaagagtattaatgcatgacaagcaagttcgaaact 107  Q
    |||| |||||||||||||| ||||| ||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| | ||||||    
2385723 cgaaaaatatcttttgtttctctctggagggctgatcattttctatatttgaatactgttatgtgaagagtattaatgcatgacaagcaaggtggaaact 2385624  T
108 catgcctataggatgatgcggcaagatcaaattaacgaaatgattacataatcggaaacaatctgtcttgaatattttactttagtatactacacatctt 207  Q
     |||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||  |||||    
2385623 aatgcctataggatgattcggcaagatcaaattgacgaaatgattacttaatcggaaacaagctgtcttgaatattttactttcgtatactac-gatctt 2385525  T
208 acaactatattatctttc----tatgtataaaccttattgctttttgaaaatttctggtaaaagaggagaggaatgggtggctttagattagaatactcg 303  Q
    |||||||||||||| |||    ||||||||||||||||||||||||||||||||| |||||||||||||||||  ||||||||||||||| |||||||||    
2385524 acaactatattatccttctatgtatgtataaaccttattgctttttgaaaatttcaggtaaaagaggagaggacagggtggctttagattggaatactcg 2385425  T
304 aatca 308  Q
     ||||    
2385424 gatca 2385420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University