View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17274_low_22 (Length: 248)
Name: NF17274_low_22
Description: NF17274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17274_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 12 - 232
Target Start/End: Complemental strand, 2385431 - 2385211
Alignment:
| Q |
12 |
atactcgaatcaaactagctttaggtgctgcacgaggccttgctcgtatccattccgaaaatggtggaaaacttgtacatggcaatgtcaaatcctcaaa |
111 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2385431 |
atactcggatcaaactagctttaggtgctgcacgaggccttgctcatatccattccaaaaatggtggaaaacttgtacatggcaatgtcaaatcctcaaa |
2385332 |
T |
 |
| Q |
112 |
tatctttcttaacactaagcaatacggatgtgtatctcatcttgacttggcaaccataatgagctcagtcgtccagcccatctcacgaggatccggatac |
211 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2385331 |
tatctttcttaacactaagcaatacgggtgtgtttctgatcttggcttggcaaccataatgagctcagtcgtccagcccatctcacgagcatccggatac |
2385232 |
T |
 |
| Q |
212 |
caagcaccagaagttacagac |
232 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
2385231 |
cgagcaccagaagttacagac |
2385211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 27 - 155
Target Start/End: Original strand, 41730922 - 41731050
Alignment:
| Q |
27 |
tagctttaggtgctgcacgaggccttgctcgtatccattccgaaaatggtggaaaacttgtacatggcaatgtcaaatcctcaaatatctttcttaacac |
126 |
Q |
| |
|
||||||||||||| ||| ||||| |||||| |||||| ||| ||||| || |||||||| |||||||| |||| ||||||||||||||||| || || |
|
|
| T |
41730922 |
tagctttaggtgcagcaagaggcattgctcaaatccatgtcgagaatggcggtaaacttgtccatggcaacatcaagtcctcaaatatctttctcaatac |
41731021 |
T |
 |
| Q |
127 |
taagcaatacggatgtgtatctcatcttg |
155 |
Q |
| |
|
|| ||||| || ||||||||| |||||| |
|
|
| T |
41731022 |
caaacaatatggttgtgtatctgatcttg |
41731050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University