View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17274_low_23 (Length: 237)
Name: NF17274_low_23
Description: NF17274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17274_low_23 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 36651268 - 36651504
Alignment:
| Q |
1 |
atgttacatgtcagttttaacgaggagacgctgatgtatgtaattcaattcagcctcatacaccccatttacactcatcaatttcttgtacagatattca |
100 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36651268 |
atgtttcatgtcggttttaacgaggagacgctgatgtatgtaattcaattcagcctcatacaccccatttacactcatcaatttcttgtacagatattca |
36651367 |
T |
|
| Q |
101 |
atggttttgcgtgacttcattccagaccttgccacaattgcagatgtagtctctaactgaatggagcttttcatgagatagctttcggtcaaaatgaact |
200 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36651368 |
atggtttcgcgtgacttcattccagatcttgccacaattgcagatgtagtctctaactgaatggagcttttcatgagatagctttcggtcaaaatgaact |
36651467 |
T |
|
| Q |
201 |
cgtgactaagactttctttctcaagcggtttatctct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36651468 |
cgtgactaagactttctttctcaagcggtttatctct |
36651504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University