View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17274_low_24 (Length: 236)
Name: NF17274_low_24
Description: NF17274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17274_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 29 - 221
Target Start/End: Original strand, 8931076 - 8931271
Alignment:
| Q |
29 |
ggaaaatgcttaatattttcacctgaagttggttgcgtttcacaagcttacgaccgtggtgcacgtgacagaattcacatagctcagagatgatatctaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931076 |
ggaaaatgcttaatattttcacctgaagttggttgcgtttcacaagcttacgaccgtggtgcacgtgacagaattcacatagctcagagatgatatctaa |
8931175 |
T |
|
| Q |
129 |
ggcacccatattttgttaaacaaaccaagaggacaatggttgctgaaattagattaagt---aataaacaatagagaaaaaagtacgtgtatataa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8931176 |
ggcacccatattttgttaaacaaaccaagaggacaatggttgctgaaattagattaagtacaaataaacaatagagaaaaaagtacgtgtatataa |
8931271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University