View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17274_low_25 (Length: 233)
Name: NF17274_low_25
Description: NF17274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17274_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 53695016 - 53695218
Alignment:
| Q |
20 |
gttcttaggaaagactcacaatggcttaaatagattatgcgttttggggataaacgggaagcatatatagtcgggtggctcacaatgatcagacatggtg |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53695016 |
gttcttaggaaagactcacgatggcttaaatagattatgcgttttggggataaacgggaagcatatatagtccggtggctcacaatgatcagacatggtg |
53695115 |
T |
 |
| Q |
120 |
agagacttaaggagtatgttcttgaaattaaagcacgaatggcattagcggccagctgccgggtttgatgtcgaatgagaaattgttagattattttctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | | | |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53695116 |
agagacttaaggagtatgttcttgaaattaaagcacgaatggcattagcggccaacggtcaggtttgatgtcgaatgagaaattgttagattattttatt |
53695215 |
T |
 |
| Q |
220 |
gga |
222 |
Q |
| |
|
||| |
|
|
| T |
53695216 |
gga |
53695218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University