View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17275_high_23 (Length: 368)
Name: NF17275_high_23
Description: NF17275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17275_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 93 - 353
Target Start/End: Original strand, 41526650 - 41526910
Alignment:
| Q |
93 |
aagggaaaagtggctgctgctaatgtgtctgatggcgtaaagcggaaaggggctcctgctatgaggataggtgattttgaattgttgatttaagtggtga |
192 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41526650 |
aaggggaaaggggctgctgctaatgtgtctgatggcgtaaaacggaaaggggctgctgctaagaggataggtgattttgaattgttgatttaagtggtga |
41526749 |
T |
|
| Q |
193 |
aaaaggctagttttgatggtaccatggcaacaattaactccgatgccttcaagataaaaatgaaggagtgttttcttgaatctcgtgctgatttgaagat |
292 |
Q |
| |
|
|||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41526750 |
aaaaagctagttttgatggtaccatggcagcggttaactccgatgccttcaagataaaaatgaaggagtgttttcttgaatctcgtgctgatttgaagat |
41526849 |
T |
|
| Q |
293 |
agttgaagaaggtgctgctgatgcaaccttgtttgttgttctgcaggattagataaaaagt |
353 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||| ||||| |||||||| |
|
|
| T |
41526850 |
agttgaaaaaggtgctgctgatgcaaccttgtttgttgctctgcagaattaggtaaaaagt |
41526910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University