View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17275_high_26 (Length: 316)
Name: NF17275_high_26
Description: NF17275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17275_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 17 - 298
Target Start/End: Original strand, 13975777 - 13976058
Alignment:
| Q |
17 |
aatatttatggctgtatcgatgtgttgttttgggtcccttctacattgatttgcttccagcaaggaggtgtatcttttatcggcttccttgcaatttttc |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13975777 |
aatatttatggctgcatcgatgtgttgttttgggtcccttctacattgatttgcttccagcaaggaggtgtatcttttatcggcttccttgcaatttttc |
13975876 |
T |
 |
| Q |
117 |
ggagcggtatttatttggtgtgcataggttacaggtcttatgaatgtttacatctcattctttcattcttttttgcctttctaatctttgttgtccttca |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13975877 |
ggagctgtatttatttggtgtgcataggttacaggtcttatgaatgtttacatctcattctttcattcttttttgcctttctaatcttcgttgtccttca |
13975976 |
T |
 |
| Q |
217 |
actattttggtgtgtgaattttgtaaaaacaatacttgtacagttataaaaatatgcatatggatctgcaatgacccaaaac |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13975977 |
actattttggtgtgtgaattttgtaaaaacaatacttgtacagttataaaaatatgcatatggatctgcaatgacccaaaac |
13976058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 21 - 163
Target Start/End: Original strand, 13991814 - 13991955
Alignment:
| Q |
21 |
tttatggctgtatcgatgtgttgttttgggtcccttctacattgatttgcttccagcaaggaggtgtatcttttatcggcttccttgcaatttttcggag |
120 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
13991814 |
tttatggctgcatcgttgtgttattttgggtcccttctacattgatttgcttccaacc-ggaagtgtatcttttatcggcttccttgcaatttttcagag |
13991912 |
T |
 |
| Q |
121 |
cggtatttatttggtgtgcataggttacaggtcttatgaatgt |
163 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13991913 |
ctgtatttatttggtgtgcataggttacaggtcttatgaatgt |
13991955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University