View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17275_low_30 (Length: 282)

Name: NF17275_low_30
Description: NF17275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17275_low_30
NF17275_low_30
[»] chr5 (1 HSPs)
chr5 (30-278)||(30968030-30968260)


Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 30 - 278
Target Start/End: Complemental strand, 30968260 - 30968030
Alignment:
30 cagttttcagactctggctttttcagtaatagagaagatcctgctacttatgaggaagctgcaaagttcaattgttggaaagaggctatggatcaggaaa 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30968260 cagttttcagactctggctttttcagtaatagagaagatcctgctacttatgaggaagctgcaaagttcaattgttggaaagaggctatggatcaggaaa 30968161  T
130 ttgaagccatagaaagaaatgatacatgggaactaactgatttaccaactggaagcaggaagattagtgtaaaatggatttataagac--aatacaatga 227  Q
    ||||||||||||||||||||||                    ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
30968160 ttgaagccatagaaagaaatga--------------------taccaactggaagcaggaagattagtgtaaaatggatttataagacaaaatacaatga 30968081  T
228 aaatggtaaagttgaaaaacacaaagccagattagtagcaaaggggtactc 278  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
30968080 aaatggtaaagttgaaaaacacaaagccagattagtagcaaaggggtactc 30968030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University