View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17275_low_32 (Length: 268)
Name: NF17275_low_32
Description: NF17275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17275_low_32 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 9 - 268
Target Start/End: Original strand, 19852838 - 19853094
Alignment:
| Q |
9 |
tactacctagatactacagtgtcattttgttttcaactttcaaacccattttgctttctcattctcattttccatagaatctgatgaagaagataatgaa |
108 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19852838 |
tactaactagctactacagtgtcattttgttttcaactttcaaacccattttgctttctcattctcattttccatagaatctgatgaagaagataatgaa |
19852937 |
T |
|
| Q |
109 |
gaaaccaatattggaagaagaagaagataccattatagaggtgaaacaagatttcatggtttcaccttcttctcaaactcaatcaaatctcagaactgct |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19852938 |
gaaaccaatattggaag---aagaagataccattatagaggtgaaacaagatttcatggtttcaccttcttctcaaactcaatcaactctcagaactgct |
19853034 |
T |
|
| Q |
209 |
tattttctcaaacccattgcaaacttcattcttaacccaccaccaccaccatcttcttct |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19853035 |
tattttctcaaacccattgcaaacttcattcttaacccaccaccaccactatcttcttct |
19853094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 239
Target Start/End: Complemental strand, 20037210 - 20037168
Alignment:
| Q |
197 |
ctcagaactgcttattttctcaaacccattgcaaacttcattc |
239 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
20037210 |
ctcagaactgctcattttctcaaacccatttcaaactccattc |
20037168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University