View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17275_low_41 (Length: 228)
Name: NF17275_low_41
Description: NF17275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17275_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 23 - 141
Target Start/End: Complemental strand, 12250747 - 12250630
Alignment:
| Q |
23 |
ttagctataaatatttaccttgctttcgttagcatttcatttcatccacacttgcttttctattggttttctttccgttaaaccatttacactttccaca |
122 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12250747 |
ttagctataaatatttaccttgcattccttagcatt-catttcatccacacttgcttttctattggttttctttcagttaaaccatttacactttccaca |
12250649 |
T |
 |
| Q |
123 |
aaatcattcatggcgtggg |
141 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12250648 |
aaatcattcatggcgtggg |
12250630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 136
Target Start/End: Complemental strand, 11120715 - 11120636
Alignment:
| Q |
60 |
catttcatccacacttgcttttctattggttttctt---tccgttaaaccatttacactttccacaaaatcattcatggc |
136 |
Q |
| |
|
|||||||||||||||| |||||||| | ||||||| || ||||||||| |||| |||| ||||||||||||||||| |
|
|
| T |
11120715 |
catttcatccacacttatttttctatagcttttcttctttcatttaaaccatatacagtttctacaaaatcattcatggc |
11120636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University