View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17275_low_43 (Length: 225)
Name: NF17275_low_43
Description: NF17275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17275_low_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 6 - 192
Target Start/End: Original strand, 18030601 - 18030788
Alignment:
| Q |
6 |
agaaaggaaagtgtggataaagcagagagcaaagcaacaaactatagctatggaatgataggggatgcgacggcgcttgaagaaaatgcggttgtggaca |
105 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
18030601 |
agaaaggaaagtgtggatagagcagagaacaaagcaacaaactatagctatggaatgataggggatgcgacggcgcttgaagacaatgcggctgtggaca |
18030700 |
T |
|
| Q |
106 |
gaacggagcggtggagcacggcctgggtccagaggttcgtaacgtcaaaaaccgaaacaaataggttttatttggg-aatttagggac |
192 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
18030701 |
gaacggagcggtggagcacggcctaggtccagaggttcgcaacgtcaaaaaccgaaacaaatgggttttatttgggaaatttagggac |
18030788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University