View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17275_low_44 (Length: 223)
Name: NF17275_low_44
Description: NF17275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17275_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 31929285 - 31929071
Alignment:
| Q |
1 |
tgtattattacatccatatttttcatgatccataaattattcaagagataaaaataaaatgaattcattatgttgcaggacctgtttaagacaagaaggg |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31929285 |
tgtattattacatccaaatttttcatgatccataaattattcaagagagaaaaataaaatgaattcattatgttgcaggacctgtttaagacaagaaggg |
31929186 |
T |
|
| Q |
101 |
aaagtaattttgccgttaagcgaaggtgaccctacgacctcacgtgtgatatctctccaccgtttgcaaacgcaggcgcaagcgacgacgtttcgacgat |
200 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31929185 |
aaagttattttgccgttaagagaaggtgaccctacgacctcacgtgtgatatctctccaccgtttgcaaacgcaggcgcaagcgacgacgtttcgacgat |
31929086 |
T |
|
| Q |
201 |
gcggccattcttctc |
215 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
31929085 |
gcggccattgttctc |
31929071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 80 - 207
Target Start/End: Complemental strand, 31923199 - 31923072
Alignment:
| Q |
80 |
acctgtttaagacaagaagggaaagtaattttgccgttaagcgaaggtgaccctacgacctcacgtgtgatatctctccaccgtttgcaaacgcaggcgc |
179 |
Q |
| |
|
|||||||||||||||||||| || || ||| |||||||| | ||||||| |||| ||||||||| ||||||||||||||||| || |||||||| | |
|
|
| T |
31923199 |
acctgtttaagacaagaaggaaaggtgattgtgccgttacgttgaggtgacttaacgatctcacgtgtaatatctctccaccgtttacacacgcaggcac |
31923100 |
T |
|
| Q |
180 |
aagcgacgacgtttcgacgatgcggcca |
207 |
Q |
| |
|
|||||||||||||| |||| |||||||| |
|
|
| T |
31923099 |
aagcgacgacgttttgacggtgcggcca |
31923072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University