View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_high_103 (Length: 288)
Name: NF17277_high_103
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_high_103 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 72 - 288
Target Start/End: Original strand, 7056090 - 7056302
Alignment:
| Q |
72 |
gttaaatattgctacatatcttaacgtaaattcgttaactagtatgtgtctggtttgccgttttgtatcccaaactcacgtctctcacagttaccagtgc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
7056090 |
gttaaatattgctacatatcttaacgtaaattcgttaactagtatgtgtctggtttgccgttttgta-cccaaactcacgtctc--acagttaccagtgc |
7056186 |
T |
 |
| Q |
172 |
ataaaggctataaattggagcatttcaatttcgtacgtttaaactttggagggatcccaaatgtggttccaaacacatcattagtaaagatgaatgttcc |
271 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7056187 |
ataaaggctctaaattggagcatt-caatttcgtacgtttaaacgttggagggatcccaaatgtggttccaaacacatcattagtatagatgaatgttcc |
7056285 |
T |
 |
| Q |
272 |
aaaaagcaatcttgatc |
288 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7056286 |
aaaaagcaatcttgatc |
7056302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 56
Target Start/End: Original strand, 7056057 - 7056088
Alignment:
| Q |
25 |
ggttttcacaactgccgcctgcaccaacagta |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7056057 |
ggttttcacaactgccgcctgcaccaacagta |
7056088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University