View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_high_124 (Length: 253)
Name: NF17277_high_124
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_high_124 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 37161063 - 37161173
Alignment:
| Q |
1 |
tactatattcaacaacaggagcatttggattcaaaagaatatccccctcactgtatttactatcctttgatctaatcactcttacaactgcaaatactgt |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37161063 |
tactatattcagcaacaggagcatttggattcaaaagaatatccccctcactgtatttactatccttggatctaatcactcttacaactgcaaatactgt |
37161162 |
T |
|
| Q |
101 |
aatcacctaca |
111 |
Q |
| |
|
||| ||||||| |
|
|
| T |
37161163 |
aatgacctaca |
37161173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 185 - 253
Target Start/End: Original strand, 37161231 - 37161299
Alignment:
| Q |
185 |
gtacctgattaagttgatattgtgaaatgaaaaggccttctgagggaccagtgattcttccacgaagat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37161231 |
gtacctgattaagttgatattgtgaaatgaaaaggccttctgaggtaccagtgattcttccacgaagat |
37161299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 29 - 108
Target Start/End: Original strand, 37150211 - 37150290
Alignment:
| Q |
29 |
attcaaaagaatatccccctcactgtatttactatcctttgatctaatcactcttacaactgcaaatactgtaatcacct |
108 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||| ||| || |||||||| |||||| ||||| ||||| |
|
|
| T |
37150211 |
attcaaaaggatatccccctcactgtatttactatccttcgatcgaattacccttacaaccgcaaatgttgtaagcacct |
37150290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 29 - 98
Target Start/End: Original strand, 37155357 - 37155426
Alignment:
| Q |
29 |
attcaaaagaatatccccctcactgtatttactatcctttgatctaatcactcttacaactgcaaatact |
98 |
Q |
| |
|
||||||||| ||||| || ||| ||||||||||||||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
37155357 |
attcaaaaggatatctccttcagtgtatttactatcctttgatcgaattactcttacaattgcaaatact |
37155426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 224
Target Start/End: Original strand, 37150504 - 37150543
Alignment:
| Q |
185 |
gtacctgattaagttgatattgtgaaatgaaaaggccttc |
224 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37150504 |
gtacctgattaagttgatattgtggaatgaaaaggccttc |
37150543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University