View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_high_133 (Length: 249)
Name: NF17277_high_133
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_high_133 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 23390821 - 23390623
Alignment:
| Q |
1 |
cttctcatcccttttattagtatatatgaaagaagaatagaagtttggtatgtcaaaatcagtgtcaacttcattagctaattacattaagttgaatgag |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| || ||| |
|
|
| T |
23390821 |
cttctcatcccttctattagtatatatgaaagaagaatagaagtttggtatgtcaaaatcagtgtcaacttcattagctatttaaattaagttaaaggag |
23390722 |
T |
 |
| Q |
101 |
gtaattaaaatcagtttctctcttcttattcnnnnnnnatcttctattttgtaggattttaaaaaatagtttgtaaccgtaatttgggtgtgacatcaa |
199 |
Q |
| |
|
|||||||||||| || ||||||||||| ||| || || | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23390721 |
gtaattaaaatctgtgtctctcttctttttcttctcttatattatcatttgtaggattttaaaaaatagtttgtaaccgtaatttgggtgtgacatcaa |
23390623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 195 - 240
Target Start/End: Complemental strand, 23390567 - 23390522
Alignment:
| Q |
195 |
atcaaggattgtgattgttgctgccgtgaccgcaacccagtctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23390567 |
atcaaggattgtgattgttgctgccgtgaccgcaacccagtctgtg |
23390522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University