View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_high_148 (Length: 238)
Name: NF17277_high_148
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_high_148 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 13136593 - 13136385
Alignment:
| Q |
18 |
taatgattacggagaaatgaatgaaaaatttagttatgctatatatatttatattagaatagtgtagttgcggcttattctctcttttagaatattatca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13136593 |
taatgattacggagaaatgaatgaaaaatttagttatgctatata-atttatattagaatagtgtagttgcagcttattctctcttttagaatattatca |
13136495 |
T |
 |
| Q |
118 |
ctctcatttatgaaaaaaccaaaatcac-tttatgtacttaaannnnnnnatgtctccatattcatcatgtgcacttgtattattaatgatttgtttata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13136494 |
ctctcatttatgaaaaaaccaaaatcacttttatgtacttaaatttttttatgtctctatattcatcatgtgcacttgtactattaatgatttgtttata |
13136395 |
T |
 |
| Q |
217 |
acatcttcat |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
13136394 |
acatcttcat |
13136385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 90 - 141
Target Start/End: Complemental strand, 45134677 - 45134626
Alignment:
| Q |
90 |
gcttattctctcttttagaatattatcactctcatttatgaaaaaaccaaaa |
141 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| || || |||||| |
|
|
| T |
45134677 |
gcttattctctcttttagaatattatctctctcatttataaacaacccaaaa |
45134626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 90 - 131
Target Start/End: Original strand, 11927118 - 11927159
Alignment:
| Q |
90 |
gcttattctctcttttagaatattatcactctcatttatgaa |
131 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
11927118 |
gcttattctctcttttagaatattatctctttcatttatgaa |
11927159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 98 - 131
Target Start/End: Complemental strand, 3905235 - 3905202
Alignment:
| Q |
98 |
tctcttttagaatattatcactctcatttatgaa |
131 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
3905235 |
tctcttttagaatattatctctctcatttatgaa |
3905202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University