View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_high_149 (Length: 238)
Name: NF17277_high_149
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_high_149 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 16994481 - 16994282
Alignment:
| Q |
18 |
tgtttgtgatatgaaattttaattgtaaatctttatgacctttatacgccagatgaatcaaactctagcttcttcaggatcattgtcaattggattgcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16994481 |
tgtttgtgatatgaaattttaattgtaaatctttatgacctttatatgc-agatgaatcaaactctagcttcttcaggatcattgtcaactggattgcac |
16994383 |
T |
 |
| Q |
118 |
aatcatctagagccctcttcaatccaaaactctaattacaactatagctatatgtcacaggctgaacataaggtaagttttcttataccctttcactcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16994382 |
aatcatctagagccctcttcaatccaaaactccaattacaactatagctatatgtcacaggctgaacataaggtaagttttcttatacccttttactcca |
16994283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 84 - 161
Target Start/End: Complemental strand, 4528102 - 4528025
Alignment:
| Q |
84 |
agcttcttcaggatcattgtcaattggattgcacaatcatctagagccctcttcaatccaaaactctaattacaacta |
161 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||| || |||||||||| |
|
|
| T |
4528102 |
agcttcttcaggatcattgtcaattggatcacacaatcatctagagtccccttcaatccaaaattcatattacaacta |
4528025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University