View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_high_155 (Length: 236)
Name: NF17277_high_155
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_high_155 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 37 - 196
Target Start/End: Complemental strand, 33591241 - 33591081
Alignment:
| Q |
37 |
aaaatataatccaaatgtgtcaaacctccataagatcatttcagagacgaatta-ggtatataaattgagacatttcaaattatttaatctaaactgtgt |
135 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33591241 |
aaaatataatccgaatgtgtcaaacctccataagatcatttcagagacgaattatggtatataaattgagacatttcaaattatttaatttaaactgtgt |
33591142 |
T |
 |
| Q |
136 |
caacacaaaaatataaactgtgctgattacctgacaccnnnnnnnatatgggtaaccaccg |
196 |
Q |
| |
|
||| |||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
33591141 |
caatacaaaaatataaactgtgttgattacctgacacctttttttatatgggtaaccaccg |
33591081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University