View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_high_166 (Length: 225)
Name: NF17277_high_166
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_high_166 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 13 - 118
Target Start/End: Complemental strand, 48013575 - 48013470
Alignment:
| Q |
13 |
gattattctaagaattatgtgcacatgactttgttgttgatgctataggatttggaatctgattgcatgtggattaataaaatcccagtcaactgcaccg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48013575 |
gattattctaagaattatgtgcacatgactttgttgttgatgctataggatttggtatctgattgcatgtggattaataaaatcccagtcaactgcaccg |
48013476 |
T |
 |
| Q |
113 |
tgccct |
118 |
Q |
| |
|
|||||| |
|
|
| T |
48013475 |
tgccct |
48013470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University