View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_high_50 (Length: 403)
Name: NF17277_high_50
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_high_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 10 - 213
Target Start/End: Complemental strand, 13136222 - 13136025
Alignment:
| Q |
10 |
caattgattctgaaggtgtataattgcttttctctctctagaaattttgctctaacaactctctag----gaaaaagtttccatcgccgtaactctcctt |
105 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
13136222 |
caattgattcgggaggtgtataattgcttttctctctctagaaattttgctctaacaactcgctagctaggaaaaagtttccaccgccgtaactc----- |
13136128 |
T |
|
| Q |
106 |
acctccccttccaatccaaacgtaaccgttgtagttgtcctttccggagttcaataagtcgagatttagcattgttcgtcgctgggttggttgcttctcg |
205 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13136127 |
-----cccttccaatccaaatgtaaccgttgtggttgtcctttctggagttcaataagtcgagatgtagcattgttcgtcgctgggttggttgcttctcg |
13136033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 282 - 390
Target Start/End: Complemental strand, 13135956 - 13135848
Alignment:
| Q |
282 |
ccaggaagatgaagttgggtggtggtgtggttccgactctctgttttcgtttgataatcttgattatggtttcctggattcaagatctggttcttggttc |
381 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13135956 |
ccaggaagatgaagttgggtggtggtatggtttcgactctctgttttcgtttgataatcttgattatggtttcctggattcaagatctggttcttggttc |
13135857 |
T |
|
| Q |
382 |
tgttcattt |
390 |
Q |
| |
|
||||||||| |
|
|
| T |
13135856 |
tgttcattt |
13135848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University