View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_high_90 (Length: 318)
Name: NF17277_high_90
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_high_90 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 32 - 289
Target Start/End: Original strand, 108507 - 108764
Alignment:
| Q |
32 |
cttgattgtaatcaaataagtatacaagagagacacagtgtacaaattgtcccaaaaattagcctaataaatgagaacaagaagatgtgaggagatatat |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
108507 |
cttgattgtaatcaaataagtatacaagagagacacagtgtacaaattgtcccaaaaattagcctaataaatgagaacaagaagatgtgaggagatatat |
108606 |
T |
 |
| Q |
132 |
ctctttttccatacttgtttttgacgatccatctaatgcaaacgaagatttacatatcccgagtcttttggcaaagtttaagtttgacctaacggtggac |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
108607 |
ctctttttccatacttgtttttgacgatccatctaatgcaaacgaagatttacatatcccgagtcttttggcaaagtttaagtttgacctaacggtggac |
108706 |
T |
 |
| Q |
232 |
gaattccagtctcagttttatggctatgagttctgacaaaaaagagagttgctttcac |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
108707 |
gaattccagtctcagttttatggctatgagttctgacaaaaaagagagttgctttcac |
108764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University