View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_108 (Length: 282)
Name: NF17277_low_108
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_108 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 17 - 263
Target Start/End: Original strand, 51010444 - 51010690
Alignment:
| Q |
17 |
cacagaagaggaacatgataacaaaagcttgatgacagaaaataatcaatatatgtttgtggatcctttagacacaaaaaagaagcaagaaaatgttgtt |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51010444 |
cacagaagaggaacatgatagcaaaagcttgatgacagaaaataatcaatatgtgtttgtggatcctttagacacaaaaaagaagcaagaaaatgttgtt |
51010543 |
T |
|
| Q |
117 |
ggcagatcagattcaatgtcagattgcagtgatcaaaatgaagaagaggatgatggaaaatataggagaagaagtggaaaaggaaaccaatcaaagaacc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51010544 |
ggcagatcagattcaatgtcagattgcagtgatcaaaatgaagaagaggatgatggaaaatataggagaagaagtggaaaaggaaaccaatcaaagaacc |
51010643 |
T |
|
| Q |
217 |
ttgttgctgagagaaaaagaaggaagaaactgaatgataggttatat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51010644 |
ttgttgctgagagaaaaagaaggaagaaactgaatgataggttatat |
51010690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University