View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_109 (Length: 281)
Name: NF17277_low_109
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_109 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 36 - 152
Target Start/End: Original strand, 3258780 - 3258896
Alignment:
| Q |
36 |
gtctcatattcgagtctttatatgaaaaaatgtggttggtaggaaaaacccacttaaagttcttgtcaaacttttcgatagagattactaatcggtgaag |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
3258780 |
gtctcatattcgagtctttatatgaaaaaatgtggttggtaggaaaaacccacttaaagttcttgtcaaatttttcgatagagattactaattggtgaag |
3258879 |
T |
 |
| Q |
136 |
tagtagacacttcgcat |
152 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3258880 |
tagtagacacttcgcat |
3258896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 169 - 266
Target Start/End: Original strand, 3258882 - 3258979
Alignment:
| Q |
169 |
gtagacacttcgcatcaagatcatcttaagaatacacttgtttggtgtagacaaaaatattgtttgctaatagaattttgaattattaccttcttttt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3258882 |
gtagacacttcgcatcaagatcatcttaagaatacacttgtttggtgtagacaaaaatattgtttgctaatagaattttgaattattaccttcttttt |
3258979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University