View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_111 (Length: 276)
Name: NF17277_low_111
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_111 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 8 - 151
Target Start/End: Original strand, 3240876 - 3241019
Alignment:
| Q |
8 |
agattattctgttagtgaatatgttcatatggactttgaaaatggtgcaaaaacaaaatgtagaagatctgaagtttctaattcagcataccaccttact |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3240876 |
agattattctgttagtgaatatgttcatatggactttgaaaatggtgcaaaaacaaaatgtagaagatctgaagtttctaattcagcataccatcttact |
3240975 |
T |
 |
| Q |
108 |
caacttgaatggcatcatagtcaatatgatgttgatgcaaatgg |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3240976 |
caacttgaatggcatcatagtcaatatgatgttgatgcaaatgg |
3241019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University