View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_118 (Length: 264)
Name: NF17277_low_118
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_118 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 179 - 264
Target Start/End: Complemental strand, 29594141 - 29594056
Alignment:
| Q |
179 |
accatcaattcaacttcaactaaagcaaattaaccccttaaaccacaaattagtgtataataataaatcattactttcgacaataa |
264 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29594141 |
accatcaattcgacttcaactaaagcaaattaaccccttaaaccacaaattagtgtataataataaatcattactttcgacaataa |
29594056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 40 - 93
Target Start/End: Complemental strand, 29597285 - 29597232
Alignment:
| Q |
40 |
tgtattgaagcctaacgtaacaaaaccgttagttgtcgtgggtacaagattgaa |
93 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| | || ||||||||||||| |
|
|
| T |
29597285 |
tgtattgaagcctaacgcaacaaaaccgttagttgccttgtgtacaagattgaa |
29597232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University