View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17277_low_127 (Length: 253)

Name: NF17277_low_127
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17277_low_127
NF17277_low_127
[»] chr2 (5 HSPs)
chr2 (1-111)||(37161063-37161173)
chr2 (185-253)||(37161231-37161299)
chr2 (29-108)||(37150211-37150290)
chr2 (29-98)||(37155357-37155426)
chr2 (185-224)||(37150504-37150543)


Alignment Details
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 37161063 - 37161173
Alignment:
1 tactatattcaacaacaggagcatttggattcaaaagaatatccccctcactgtatttactatcctttgatctaatcactcttacaactgcaaatactgt 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
37161063 tactatattcagcaacaggagcatttggattcaaaagaatatccccctcactgtatttactatccttggatctaatcactcttacaactgcaaatactgt 37161162  T
101 aatcacctaca 111  Q
    ||| |||||||    
37161163 aatgacctaca 37161173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 185 - 253
Target Start/End: Original strand, 37161231 - 37161299
Alignment:
185 gtacctgattaagttgatattgtgaaatgaaaaggccttctgagggaccagtgattcttccacgaagat 253  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
37161231 gtacctgattaagttgatattgtgaaatgaaaaggccttctgaggtaccagtgattcttccacgaagat 37161299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 29 - 108
Target Start/End: Original strand, 37150211 - 37150290
Alignment:
29 attcaaaagaatatccccctcactgtatttactatcctttgatctaatcactcttacaactgcaaatactgtaatcacct 108  Q
    ||||||||| ||||||||||||||||||||||||||||| |||| ||| || |||||||| ||||||  ||||| |||||    
37150211 attcaaaaggatatccccctcactgtatttactatccttcgatcgaattacccttacaaccgcaaatgttgtaagcacct 37150290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 29 - 98
Target Start/End: Original strand, 37155357 - 37155426
Alignment:
29 attcaaaagaatatccccctcactgtatttactatcctttgatctaatcactcttacaactgcaaatact 98  Q
    ||||||||| ||||| || ||| ||||||||||||||||||||| ||| |||||||||| ||||||||||    
37155357 attcaaaaggatatctccttcagtgtatttactatcctttgatcgaattactcttacaattgcaaatact 37155426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 224
Target Start/End: Original strand, 37150504 - 37150543
Alignment:
185 gtacctgattaagttgatattgtgaaatgaaaaggccttc 224  Q
    |||||||||||||||||||||||| |||||||||||||||    
37150504 gtacctgattaagttgatattgtggaatgaaaaggccttc 37150543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University