View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17277_low_139 (Length: 247)

Name: NF17277_low_139
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17277_low_139
NF17277_low_139
[»] chr2 (1 HSPs)
chr2 (46-247)||(26287979-26288180)


Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 46 - 247
Target Start/End: Complemental strand, 26288180 - 26287979
Alignment:
46 aatatgatatcatattagaatttgaatcgggtctaatttaactttagaaagtgatagaacttttaaacttattttcatgttaaatctcattaaatgtgag 145  Q
    |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
26288180 aatatgatatcatattagaatttgaatcggatctaatttaactttacaaagtgatagaacttttaaacttattttcatgttaaatctcattaaatgtgag 26288081  T
146 acatttagcaactaccttcggcgatctcaacggttgattatgatcaaacgattgaaatttaaaattattgattggacaactttacattttgagcagtttg 245  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26288080 acatttagcaactaccttcggcgatctcaacggttgattatgatcaaacgattgaaatttaaaattattgattggacaactttacattttgagcagtttg 26287981  T
246 at 247  Q
    ||    
26287980 at 26287979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University