View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_139 (Length: 247)
Name: NF17277_low_139
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_139 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 46 - 247
Target Start/End: Complemental strand, 26288180 - 26287979
Alignment:
| Q |
46 |
aatatgatatcatattagaatttgaatcgggtctaatttaactttagaaagtgatagaacttttaaacttattttcatgttaaatctcattaaatgtgag |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26288180 |
aatatgatatcatattagaatttgaatcggatctaatttaactttacaaagtgatagaacttttaaacttattttcatgttaaatctcattaaatgtgag |
26288081 |
T |
 |
| Q |
146 |
acatttagcaactaccttcggcgatctcaacggttgattatgatcaaacgattgaaatttaaaattattgattggacaactttacattttgagcagtttg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26288080 |
acatttagcaactaccttcggcgatctcaacggttgattatgatcaaacgattgaaatttaaaattattgattggacaactttacattttgagcagtttg |
26287981 |
T |
 |
| Q |
246 |
at |
247 |
Q |
| |
|
|| |
|
|
| T |
26287980 |
at |
26287979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University