View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_141 (Length: 246)
Name: NF17277_low_141
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_141 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 146 - 245
Target Start/End: Complemental strand, 31628768 - 31628669
Alignment:
| Q |
146 |
gagagttagaatgagaatgagagcttttaaatgtttgttgataataaattattttctctgtgggcagtgttgtactgtttgctactttgcgtttctgtgt |
245 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31628768 |
gagagttagaatgagaatgagaacttttaaatgtttgttgataataaattattttctctgtgggcagtgttgtactgtttgctactttgcgtttccgtgt |
31628669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 31628915 - 31628835
Alignment:
| Q |
1 |
tgaagatcaatgtctgtgatgctgttaaagacggttttcgtggtccaagacgagagtgtctgaatttcaccataatagttt |
81 |
Q |
| |
|
|||||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31628915 |
tgaagatcaatgtctgagacgctgttaacgacggttttcgtggtccaagacgagagtgtctgaatttcaccataatagttt |
31628835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University