View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_142 (Length: 246)
Name: NF17277_low_142
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_142 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 13 - 246
Target Start/End: Original strand, 33925514 - 33925747
Alignment:
| Q |
13 |
atactgcaaattaatatcgatcttgcggtttgcaacaaatgcaatcaatattatagttgcaatttcgctgcagaatcaattaaaagttgaactgcaattt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33925514 |
atactgcaaattaatatcgatcttgcggtttgcaacaaatgcaatcaatattatagttgcaatttcgctgcagaatcaattaaaagttgaactgcaattt |
33925613 |
T |
|
| Q |
113 |
agaactatatatgaacaatcaaatcatcagcgtttaaccagaaaactaatcatcaacttctactactgattcagtcactaacctaaaattaaacatagcg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33925614 |
agaactatatatgaacaatcaaatcatcagcgtttaaccagaaaactaatcatcaacttctactactgattcagtcactaacctaaaattaaacatagcg |
33925713 |
T |
|
| Q |
213 |
tagaaaagatcagagaatgtacagaaaatattaa |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33925714 |
tagaaaagatcagagaatgtacagaaaatattaa |
33925747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University