View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_145 (Length: 243)
Name: NF17277_low_145
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_145 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 20 - 229
Target Start/End: Complemental strand, 10604959 - 10604750
Alignment:
| Q |
20 |
tagaacacttacaaaatctgcaattcagatagtgatccaatttctgaagaaagctggccagacaaatccatgcttgacaatgatctgaaatactagcaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10604959 |
tagaacacttacaaaatctgcaattcagatagtgatccaatttctgaagaaagctggccagacaaatccatgcttgacaatgatctgaaatactagcaac |
10604860 |
T |
|
| Q |
120 |
caattgttaaccccatgtcagacaattcaggagaggtttgcttcatttaataatttaagnnnnnnngtacatggtgataacgcgcgaattggagcactca |
219 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10604859 |
caattgttaaacccatgtcagacaactcaggagaggtttacttcatttaataatttaagaaaaaaagtacatggtgataacgcgcgaattggagcactca |
10604760 |
T |
|
| Q |
220 |
atgccttccc |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
10604759 |
atgccttccc |
10604750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 95
Target Start/End: Complemental strand, 32212941 - 32212875
Alignment:
| Q |
29 |
tacaaaatctgcaattcagatagtgatccaatttctgaagaaagctggccagacaaatccatgcttg |
95 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| | | ||||||| |||||||||||||||||||| |
|
|
| T |
32212941 |
tacaaaatccacaattcagatagtaatccaatatgttctgaaagctagccagacaaatccatgcttg |
32212875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University