View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_148 (Length: 239)
Name: NF17277_low_148
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_148 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 26287998 - 26287778
Alignment:
| Q |
1 |
tacattttgagcagtttgatctctatcaaacggttgtaaatagaccaactgcactggacaaaagaaaattcttagagaaaggaatcaaatcaaaatctag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26287998 |
tacattttgagcagtttgatctctatcaaacggttgtaaatagaccaactgcactggacaaaagaaaattcttagagcaaggaatcaaatcaaaatctag |
26287899 |
T |
 |
| Q |
101 |
aaacaaggcaaataaatcaaccatcaaggataggtaaaaaaggctaatcaagcatagaggttgaacttgagcccaaaatggaccatacatagtctagttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26287898 |
aaacaaggcaaataaatcaaccatcaaggataggtaaaaaaggctaatcaagcatagaggttgaacttgagcccaaaatggaccatacatagtctacttc |
26287799 |
T |
 |
| Q |
201 |
tgcatgagtataccacaagcc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26287798 |
tgcatgagtataccacaagcc |
26287778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University