View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_159 (Length: 236)
Name: NF17277_low_159
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_159 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 47621434 - 47621225
Alignment:
| Q |
1 |
gctgagttactctaataactcaatataagcattcagtttcaccaatccaatcgtccaattagcatttctttcgaacaaataacctcacaactttttgtaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
47621434 |
gctgagttactctaataactcaatataagcattcagtttcaccaatccaatcgtccaattagcatttcttttgaacaaataacttcacaactttttgtaa |
47621335 |
T |
|
| Q |
101 |
aattttacttgatactcactaattgtaaaattttacgagaatgagaaggcatgcagggatggaaccagaaaataatcaagcgtggaaaaaagttatagag |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47621334 |
a-----------tactcactaattgtaaaattttacgagaataagaatgcatgcagggatggaaccagaaaataatcaagtgtggaaaaaagttatagag |
47621246 |
T |
|
| Q |
201 |
taactttgtgacgacaatagt |
221 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
47621245 |
taactttgggacgacaatagt |
47621225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University