View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_170 (Length: 224)
Name: NF17277_low_170
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_170 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 36 - 214
Target Start/End: Original strand, 24456668 - 24456848
Alignment:
| Q |
36 |
ctaacccttcatcttccgaacttcttcgccaatttcaagtagctcttaaacgccgtcgaaatcccggtaccgttcttcttctcataa--ttttttatgtt |
133 |
Q |
| |
|
|||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
24456668 |
ctaacccttcctcttccgaactcctccgccaatttcaagtagctcttaaacgccgtcgaaaccccggtaccgttcctcttctcataactttttttatgtt |
24456767 |
T |
|
| Q |
134 |
tctacttcttcattcagtttctgttgttaatttttgtgaattctttatcaggtggtgcgttgcaatcgaatattcttcgac |
214 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24456768 |
tctacttcttcattcagtttctgatgttaatttttgtgaattctttatcaggtggtgcgttgcaatcgaatattattcgac |
24456848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University