View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_185 (Length: 205)
Name: NF17277_low_185
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_185 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 103 - 188
Target Start/End: Complemental strand, 52593420 - 52593335
Alignment:
| Q |
103 |
aatcatgaggcagtagtatgtctctctttattttgtcctttttaaaaaagtctgtgatcatgaaatgattatgatggggtagtagt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52593420 |
aatcatgaggcagtagtatgtctctctttattttgtcctttttaaaaaagtctgtgatcatgaaatgattatgatggggtagtagt |
52593335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 13 - 44
Target Start/End: Complemental strand, 52593503 - 52593472
Alignment:
| Q |
13 |
ataattctctattgcacctctgcttgctctgg |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52593503 |
ataattctctattgcacctctgcttgctctgg |
52593472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University