View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_38 (Length: 441)
Name: NF17277_low_38
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 7 - 426
Target Start/End: Complemental strand, 28742194 - 28741770
Alignment:
| Q |
7 |
gaagcatagggttcgtcttggaaggtgttgctgcttccgtgtgttggttgttttttcttgcctttgatctttggttctttttagatatgttgagatttgc |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28742194 |
gaaggatagggttcgtcttggaaggtgttgctgcttacgtgtgttggttgttttttcttgcctttgatctttggttctttttagatatgttgagattcgt |
28742095 |
T |
 |
| Q |
107 |
tgtttgcaagaggtgtttcagttgccatcactgcaccggtagttctatcgtcgttgattaggctcaaaatcgaggttaagcttgttgtgaatagggtttt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28742094 |
tgtttgcaagaggtgtttcagttgccatcaccgcaccggtagttctatcgtcgttgattaggctcaaagtcgaggttaagcttgttgtgaatagggtttt |
28741995 |
T |
 |
| Q |
207 |
tggtacgtgaatctcttcgtattagcggtcgattcatttgcatgtgtcaaaagatgggcat----gattattcaagctcatctctagtttgtttaatgct |
302 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28741994 |
tggtacgtgaatctattcgtattagcggttgattcatttgcatgtgtcaaaagatgggcatgattgattattcaagctcatctctagtttgtttaatgct |
28741895 |
T |
 |
| Q |
303 |
tgcaacnnnnnnnnnnnnnnnnnnnnngcaatctgatttaagaccctgttttgggttcgttggattgtgtgtgtacctatcttctaggca-ttgggctct |
401 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28741894 |
tgcaactttttacacattttttcttttgcaatctgatttaagaccctgttttgggttcgttggattgtgtgtgtacctatcttctaggcatttgggctct |
28741795 |
T |
 |
| Q |
402 |
ttactagatttttgtcctatttttt |
426 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
28741794 |
ttactagatttttgtcctatttttt |
28741770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University