View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_55 (Length: 395)
Name: NF17277_low_55
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 379
Target Start/End: Complemental strand, 3744163 - 3743785
Alignment:
| Q |
1 |
ccacctttttactacgcttatggtgatggaagcttcgtcgctaatctctaccaacaaacactgtctatctctactcttcatcttcagaatttcacgtttg |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||| || ||||||||||| ||| ||||| ||||||||||||| || |||||||||| |
|
|
| T |
3744163 |
ccacctttttactatgcttatggtgatggaagcttcgtagctaatctgtatcaacaaacactttctctctcttctcttcatcttcaaaacttcacgtttg |
3744064 |
T |
|
| Q |
101 |
gttgtgctcatactgcactcgctgaacccaccggcgtagctggttttggccgcggaattttatctcttccggcacagctctctactctctcacctcattt |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3744063 |
gttgtgctcatactgcacttgctgaacccaccggcgtagctggttttggccgcggaattttatctcttccggcacagctctctactctctcacctcattt |
3743964 |
T |
|
| Q |
201 |
gggtaatcgtttttcttattgtttagtttctcactctttcgacggtgacagactccggcgaccgagtccactcattctcggtcgtcacaatgacaccata |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3743963 |
gggtaatcgtttttcttattgtttagtttctcactctttcgacggtgacagactccggcgaccgagtccactcattctcggtcgtcacaatgacaccata |
3743864 |
T |
|
| Q |
301 |
accggcgccggagacggagaatctgttgagtttgtctatacttccatgctttcaaacccaaagcatccttattactatt |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3743863 |
accggcgccggagacggagaatctgttgagtttgtctatacttccatgctttcaaacccaaagcatccttattactatt |
3743785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University