View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_84 (Length: 330)
Name: NF17277_low_84
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_84 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 8e-49; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 19 - 129
Target Start/End: Original strand, 2463343 - 2463453
Alignment:
| Q |
19 |
actaataaccttaagactcataggattttagaggtcatatgacaacctcctttgtttaactggatcaaatctaatacagatgacacatcgttaggttctc |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2463343 |
actaataaccttaaggctcataggattttagaggtcatacgacaacctcctttgtttaactggatcaaatctaatacagatgacacatccttaggttctc |
2463442 |
T |
|
| Q |
119 |
ttggcccttct |
129 |
Q |
| |
|
||||||||||| |
|
|
| T |
2463443 |
ttggcccttct |
2463453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 131 - 223
Target Start/End: Original strand, 2463487 - 2463579
Alignment:
| Q |
131 |
ttggtttgaatctttgtcaatcttatgctctttttgctgagcttatgggagtgattcttgcaattgagttcgcttattaaggaaacatgaatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2463487 |
ttggtttgaatctttgtcaatcttatgctctttttgctgagcttatgggagtgattcttgcaattgagttcgcttattaaggaaacatgaatt |
2463579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 217 - 279
Target Start/End: Original strand, 2463970 - 2464032
Alignment:
| Q |
217 |
atgaattgcggtagaaaagaggcaatgggattaagacgtctgaatatttgtgtccatcttttg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2463970 |
atgaattgcggtagaaaagaggcaatgggattaagacgtctgaatatttgtgtccaacttttg |
2464032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University