View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17277_low_97 (Length: 314)
Name: NF17277_low_97
Description: NF17277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17277_low_97 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 7 - 291
Target Start/End: Complemental strand, 26547270 - 26546986
Alignment:
| Q |
7 |
ctactgccattaaaagaatctgttggtcatactgaggttgaagtcgtagctggtggtttacttggatttttggttgggctggctgtgtataatttgaagt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26547270 |
ctactgccattaaaagaatctgttggtcatactgaggttgaagtcgtagctggtggtttacttggatttttggttgggctggctgtgtataatttgaagt |
26547171 |
T |
|
| Q |
107 |
gaaatcttgannnnnnnatgaattatttcataatgttatacattatattgaataggttatagaaatgaaaagtaaagagggagatgtcaagtcagttata |
206 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26547170 |
gaaatcttgatttttttatgaattatttcataatgttatacattatattgaataggttatagaaatgaaaagtaaagagggagatatcaagtcagttata |
26547071 |
T |
|
| Q |
207 |
gataggtttagggttgttttctttgaacaaatatcatgtgtatcatagagtatttatttattattattgatcaaatggaaacaaa |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26547070 |
gataggtttagggttgttttctttgaacaaatatcatgtgtagcatagagtatttatttattattattgatcaaatggaaacaaa |
26546986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University