View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17278_low_7 (Length: 273)
Name: NF17278_low_7
Description: NF17278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17278_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 255
Target Start/End: Original strand, 8101626 - 8101865
Alignment:
| Q |
16 |
atccaaaatgcaactaattatgtgattggatcctatgcttgtgagtcttgggttttagttggagcacgtgatcctcgagctataacagtttttcccttag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8101626 |
atccaaaatgcaactaattatgtgattggatcctatgcttttgagtcttgggttttagttggagcacgtgatcctcgagctataacagttttttccttag |
8101725 |
T |
|
| Q |
116 |
cagtacagaaaatacagcaatgaaatgcagattaagcaatctcagtcaatatcaggagcttctccaaatacaactttctacaaagtaactgtcatcactc |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8101726 |
cagtacagaaaatacagcaatgaagtgcagattaagcaatctcaatcaatatcaggagcttctccaaatacagctttctacaaagtaactgtcatcactc |
8101825 |
T |
|
| Q |
216 |
tcttcttcatcactgttaacaacataatcagagttagata |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8101826 |
tcttcttcatcactgttaacaacataatcagagttagata |
8101865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University