View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17279_high_15 (Length: 231)
Name: NF17279_high_15
Description: NF17279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17279_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 38591801 - 38591599
Alignment:
| Q |
13 |
agaaaataagggtatgtgcttttggggaagggcttaaacaagagaaactataatccatgaatgtcaacctctaccatacgtgtatttgggccatcttagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38591801 |
agaaaataagggtatgtgcttttggggaagggcttaaacaagagaaactataatccatgaatgtcaacctctactatacgtgtatttgggccatcttagt |
38591702 |
T |
 |
| Q |
113 |
ttcctttttatcttcaattcaaatgcttccttttcaaatctcatcttattttatacactatgctttaataatgttcacataaatttatgcatatatagta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38591701 |
ttcctttttatcttcaattcaaatgcttccttttcaaatctcatcttattttatacactatgctttaataatgttcacataaatttatgcatatatagta |
38591602 |
T |
 |
| Q |
213 |
gtt |
215 |
Q |
| |
|
||| |
|
|
| T |
38591601 |
gtt |
38591599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University