View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17279_high_19 (Length: 207)
Name: NF17279_high_19
Description: NF17279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17279_high_19 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 15 - 207
Target Start/End: Complemental strand, 27422402 - 27422210
Alignment:
| Q |
15 |
tatagtcaattccacatgaaaataaatcgctcgcattcacaattcacacatacagataaatccctcttccattagaatatgcaaataggtgagcttctca |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27422402 |
tataggcaattccacatgaaaataaatcgctcgcattcacaattcacacatacagataaatccctcttccattagaatatgcaaataggtgagcttctca |
27422303 |
T |
 |
| Q |
115 |
ggagacattaagaaattcttccatctttcttgcgttgttttcttcatagtttccaacaatagattgtcgagaaaatgaactgtacaaaaataa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
27422302 |
ggagacattaagaaattcttccatctttcttgcgttgttttcttcatagtttccaacaatagattgtcgagaaaacgaactgcacaaaaataa |
27422210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University