View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17279_high_6 (Length: 395)
Name: NF17279_high_6
Description: NF17279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17279_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 9 - 380
Target Start/End: Original strand, 13773502 - 13773860
Alignment:
| Q |
9 |
gattatactgtaaaaactactttccgtctttctcttcaagaatttgttgatacgtctcactttatggtgaatggctcatgaaatttgatttggaggataa |
108 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
13773502 |
gattatactgtaaaaactactttccgcctttctcttcaagaatttgttgatacgtctcactttaggg--aatggctcatgaaatttgatttggaggataa |
13773599 |
T |
 |
| Q |
109 |
aggctccgccgaaggttaaggatcttatatggcgggtgtctagacagtaccttccaactcgtatttgattgaatgacacaggagctaattgtccaactca |
208 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13773600 |
aggctccaccgaaggttaaggatcttatatggcgggtgtctagacagtaccatccaactcgtatttgattgaatgacacaggagctaattgtccaactca |
13773699 |
T |
 |
| Q |
209 |
ttgtgttctatgcactaataatgatgaggattgtaaacatgtgtttttcggataactcagtaggcaaaacatatggagttcatgtggtttatctcaaact |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13773700 |
ttgtgttctatgcactaataatgatgaggattgtaaacatgtgtttttcggataactcagtaggcaaaacatatggagttcatgtggtttatc------- |
13773792 |
T |
 |
| Q |
309 |
gtaatttctgcctcttatcatgacaacaactttgcagctgctgttgtttttcagataatacatcaattatct |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
13773793 |
----tttctgcctcttatcatgacaacaactttgcagctgctgctgtttttcagataatacatcaaatatct |
13773860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University