View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17279_low_13 (Length: 238)
Name: NF17279_low_13
Description: NF17279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17279_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 32 - 216
Target Start/End: Complemental strand, 8755828 - 8755643
Alignment:
| Q |
32 |
tttaactattcgttacgcaatttgaaactaaaataactattatctacatttataata-aaaaataggaaaatttgatgtgtagctttaaccacacatagc |
130 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8755828 |
tttaactatttgttacacaatttgaaactaaaataactattatccacatttataatagaaaaataggaaaatttgatgtgtagctttaaccacacatagc |
8755729 |
T |
|
| Q |
131 |
ttatgaatggctctgtccccgatctaaagataataattcaaattgaaatttaaaccatacattatatatgcatcaacagtggcaga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8755728 |
ttatgaatggctctgtccccgatctaaagataataattcaaattgaaatttaaaccatacagtatatatgcatcaacagtggcaga |
8755643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 127
Target Start/End: Complemental strand, 1249110 - 1249041
Alignment:
| Q |
58 |
actaaaataactattatctacatttataataaaaaataggaaaatttgatgtgtagctttaaccacacat |
127 |
Q |
| |
|
|||||||| ||||||| || |||||||||||||||||| || || ||||||| |||||| |||||||| |
|
|
| T |
1249110 |
actaaaatgactattacctctatttataataaaaaatagagaagttggatgtgtggctttagccacacat |
1249041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University