View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17279_low_16 (Length: 231)
Name: NF17279_low_16
Description: NF17279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17279_low_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 28 - 231
Target Start/End: Original strand, 29188803 - 29189006
Alignment:
| Q |
28 |
gtacgtacctcacctataaatcttatatgatgtcacattaatgatcttgttctagcatctatcatagaaaaagcaacataatccgcataataaggtggcc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29188803 |
gtacgtacctcacctataaatcttatatgatgtcacattattgatcttgttctagcatctatcatagaaaaagcaacataatccgcataataaggtggcc |
29188902 |
T |
 |
| Q |
128 |
gtaaattaaaccgtttatttaatttttatgagtaattcattaaagaccttcctcaatactataatcagaccaaattttttattaaatgctaatcacattg |
227 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29188903 |
gtaaattaaaccttttatttaatttttatgagtaattcattaaagaccttcctcaatactataatcagaccaaattttttattaaatgctaatcacattg |
29189002 |
T |
 |
| Q |
228 |
cata |
231 |
Q |
| |
|
|||| |
|
|
| T |
29189003 |
cata |
29189006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University